| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.068647 |
| Chromosome: | chromosome 9 |
| Location: | 5925313 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412000 | (1 of 26) IPR013026//IPR019734 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | 3'UTR | |
| Cre09.g412050 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAAGCCACACGTCGACACGCCGGCCCCACCCATCTCCCCGCGGACCT |
| Internal bar code: | GGTGGTCTAGTGGTGCAGTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1324 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTAGGATTCGGGCTACCC |
| Suggested primer 2: | CACAGACACACAGCTTTGGC |