Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.068720 |
Chromosome: | chromosome 11 |
Location: | 4192227 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481500 | HIS7 | Imidazole glycerol phosphate synthase; (1 of 1) K01663 - glutamine amidotransferase / cyclase (HIS7) | 5'UTR_intron |
Cre11.g481550 | (1 of 1) K03136 - transcription initiation factor TFIIE subunit alpha (TFIIE1, GTF2E1, TFA1, tfe) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGCGTATTTCCCTTCCACTCGCCCACGCCTAGGACTCGAGAGCTTGT |
Internal bar code: | GTAGGGCTGGCATAGATGAAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1481 |
LEAP-Seq percent confirming: | 88.2353 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCCTTCCCTAGTCCCCTC |
Suggested primer 2: | TCACATCGCGGATCGTGTAG |