| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.068775 |
| Chromosome: | chromosome 1 |
| Location: | 6072649 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042900 | RRM1 | Putative rRNA (adenine-N6-)-methyltransferase; (1 of 1) 2.1.1.183 - 18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTCAGGGCAGCCCAGAGGTGCGCGACCGCTAAGCCCATGACGCACCC |
| Internal bar code: | AGTTTTCTGAAGCTGTGTTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 538 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTTTCCGTCGTTTACCGT |
| Suggested primer 2: | TCAGCCGCAAAAACAAGACG |