| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.068831 |
| Chromosome: | chromosome 12 |
| Location: | 7348245 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557900 | HYD1,CDI1 | C-8%252C7 sterol isomerase; (1 of 1) 5.3.3.5 - Cholestenol Delta-isomerase | 3'UTR |
| Cre12.g557950 | DNJ27 | (1 of 1) K09528 - DnaJ homolog subfamily C member 8 (DNAJC8); DnaJ-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACCTTCCACTCGTAGACCTCTGCACTTCCCCTGTTCGCCACCTTATC |
| Internal bar code: | CGTCCTGAGGCCAGCGTGTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1569 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGCGTCAAAATGCAGGTT |
| Suggested primer 2: | TCTTTCCAACGGCTGCTGAT |