| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.068831 |
| Chromosome: | chromosome 13 |
| Location: | 1540741 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572850 | FBB17 | (1 of 6) PF00246 - Zinc carboxypeptidase (Peptidase_M14); Flagellar/basal body protein 17 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTGGAGCTACATGTGCCGCATGAGGACGACAGCACGACGCCAGGGTG |
| Internal bar code: | GTTAAGTAGGTGCAGGTCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 909 |
| LEAP-Seq percent confirming: | 93.5484 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGCACATACTCGCACGAG |
| Suggested primer 2: | CCCCAACTCAAACGCCCTAT |