| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.069052 |
| Chromosome: | chromosome 1 |
| Location: | 7149492 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051174 | BLZ1 | (1 of 6) PF07716 - Basic region leucine zipper (bZIP_2); bZIP transcription factor | outside_mRNA |
| Cre01.g051211 | MAE9 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTATAGTGTGCTCAACTTGGATGAAGCACGGGATCGTTGTTGACCTTC |
| Internal bar code: | CTGAGCCTGGCTGACTGTGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2466 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTGCCGTTTTGGTTCTC |
| Suggested primer 2: | CGCGTTTGAAGTCAGCACAA |