| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069244 |
| Chromosome: | chromosome 9 |
| Location: | 4833310 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402775 | VTC4,ROC81 | (1 of 1) PF02656//PF03105//PF09359 - Domain of unknown function (DUF202) (DUF202) // SPX domain (SPX) // VTC domain (VTC); Polyphosphate Polymerase activity | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAAAAGGTGGCTCTCCCTTGCAAGGGAAAAGTGGGCTGTGCCGCCACG |
| Internal bar code: | GTTTGTAAGTCGTAGCCAACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1744 |
| LEAP-Seq percent confirming: | 91.4286 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGCTGGCCCAAATCTGT |
| Suggested primer 2: | GGTCGTTGACTCGGACAACT |