| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.069404 |
| Chromosome: | chromosome 13 |
| Location: | 4873823 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605150 | MSD2 | Mn superoxide dismutase; (1 of 1) PTHR11404//PTHR11404:SF6 - SUPEROXIDE DISMUTASE 2 // SUPEROXIDE DISMUTASE [MN], MITOCHONDRIAL | 3'UTR |
| Cre13.g605200 | MMP29 | Matrix metalloproteinase; (1 of 40) 3.4.24.38 - Gametolysin / Lysin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCCAGTGCCTGCTTGCCGTGCCACCATCTAAGCTACCTGGGTGCCTG |
| Internal bar code: | GATAGATATACGTATCATAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1412 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCATGTTTGACACCAAGG |
| Suggested primer 2: | ATCGTCAACTGGCAGAACGT |