| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.070379 |
| Chromosome: | chromosome 12 |
| Location: | 5642561 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531550 | EIF5B3,EIF5Bd,EIF2B | Eukaryotic translation initiation factor 2, beta subunit; (1 of 1) K03238 - translation initiation factor 2 subunit 2 (EIF2S2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTCGACGGGGACTCGGTAGGTAGGCTTGGGTTTCACAGGGCCCCCATG |
| Internal bar code: | TTAACAAGGCAATTTCATCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4337 |
| LEAP-Seq percent confirming: | 97.0149 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCAGTTGCACTATCATGC |
| Suggested primer 2: | ACTGGAGTTAAGGCCCATGC |