Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.070776 |
Chromosome: | chromosome 16 |
Location: | 3300604 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g666334 | RFS1 | (1 of 1) 2.4.1.82 - Galactinol--sucrose galactosyltransferase / Raffinose synthase; putative raffinose synthase | intron |
Cre16.g666400 | MAD1 | (1 of 1) K06638 - mitotic spindle assembly checkpoint protein MAD1 (MAD1L); putative mitotic spindle assembly checkpoint protein | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACCCTCCCAACCCTCCCTACCCTCGTCCCAACTCACTTGGCGGGTGC |
Internal bar code: | ATCGTTGTTAGATCCGTGGAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2497 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACAAAAACGCAGTGGCTA |
Suggested primer 2: | AGAGTGTGAGAAGGCCATGC |