| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071466 |
| Chromosome: | plastome |
| Location: | 64728 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802291 | ChreCp027,psbZ,2716976 | photosystem II reaction center Z protein; (1 of 1) K02724 - photosystem II PsbZ protein (psbZ) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTATATACTGCAGCAAAATTTATTTGCTGCGCTAGCAGGTTTACATAC |
| Internal bar code: | TGGGCGTGGACTGCGTTTTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 68.9655 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTGCACCGTGTTTGTTC |
| Suggested primer 2: | GGCACTTTAGTCTTGCGCAG |