| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.071857 |
| Chromosome: | chromosome 12 |
| Location: | 1905026 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g511900 | RPE1 | Ribulose phosphate-3-epimerase, chloroplastic; (1 of 1) PTHR11749//PTHR11749:SF4 - RIBULOSE-5-PHOSPHATE-3-EPIMERASE // D-RIBULOSE-5-PHOSPHATE-3-EPIMERASE | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCTCTTCCATCACGTGCTGCATCTCGACGTACGGGAACTTGGCAGC |
| Internal bar code: | CTGGTGCGGGGGAAGGAAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5012 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAAGGCCGCGAAACTCAA |
| Suggested primer 2: | ATGTGCGGTAATGCCAGTCA |