| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.071944 |
| Chromosome: | plastome |
| Location: | 172661 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802328 | psbJ,2716960,ChreCp063 | (1 of 1) K02711 - photosystem II PsbJ protein (psbJ); photosystem II reaction center protein J | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATACTCCGAAGGAGGCAGTTGCCTGCCAACTGACTCCGAAGGAGACAGT |
| Internal bar code: | TTGCCGTGGGTTCGACTTGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTTCGGGCAACTAAAGT |
| Suggested primer 2: | CAGCCTCACAGTTTGCCAAG |