| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072161 |
| Chromosome: | chromosome 9 |
| Location: | 5339604 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407700 | CEP1 | (1 of 1) K16292 - KDEL-tailed cysteine endopeptidase [EC:3.4.22.-] (CEP, CYSEP); Cysteine endopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGTGGATCTCGCACTACATTTCTGGTTTGGACGGCGATTCCTGAACTA |
| Internal bar code: | AACGAAGAGGCCTCCAATTACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 28.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGAACCAGAGACAGGGTG |
| Suggested primer 2: | CATGCAGGTGGCTCTGAAGA |