| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.073029 |
| Chromosome: | chromosome 1 |
| Location: | 7128652 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051050 | FAP225 | (1 of 18) PTHR10891 - EF-HAND CALCIUM-BINDING DOMAIN CONTAINING PROTEIN; Flagellar Associated Protein 225 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTTACTGCATCACCCACATCACCCACGCTCGCCGCCAGTCCGCCCAG |
| Internal bar code: | AAATCCTTTTTACCAGCTGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1704 |
| LEAP-Seq percent confirming: | 37.931 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGCAACCCTTCTGCCTG |
| Suggested primer 2: | TCACCTGCCTGAGCCTCTAT |