| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073055 |
| Chromosome: | chromosome 12 |
| Location: | 3346084 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498450 | (1 of 1) K11493 - regulator of chromosome condensation (RCC1) | 3'UTR | |
| Cre12.g498500 | DEG1C,DEG11 | (1 of 1) PF00089//PF13180 - Trypsin (Trypsin) // PDZ domain (PDZ_2); Deg protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACACACCAATGCACGTTTGTACGTCCAGTCCTGTCGGTCATGCTGCGT |
| Internal bar code: | TGATTGGAAATACGCGTTCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3794 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAAGGCTCATTGAAGCGC |
| Suggested primer 2: | TGAACTGCAGGCTGATGAGG |