Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.074029 |
Chromosome: | chromosome 11 |
Location: | 2526936 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095101 | (1 of 1) PTHR24012:SF459 - RNA-BINDING PROTEIN 4F | 3'UTR | |
Cre02.g095102 | VPS5C | (1 of 4) PTHR10555:SF84 - SORTING NEXIN-8; Subunit of Retromer complex | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGTCTCCGCAAACATTGCCGCCAGCTGCTTCCTCCTCGCTTCTACTC |
Internal bar code: | TTCTTCCGTCACATCAGCTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 415 |
LEAP-Seq percent confirming: | 93.1034 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCCATCGCTCCCTCTACA |
Suggested primer 2: | AGACGCAGAAGTGGACGAAG |