| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.074167 |
| Chromosome: | chromosome 1 |
| Location: | 4669722 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032300 | GBP1 | G-strand telomere DNA binding protein; (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGCTCGGTGCTACAGGCCCGGCAGGCCCAGCCCCGCGCGCCTCCCCC |
| Internal bar code: | TCGGTGAGGTTCCTGTTAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1324 |
| LEAP-Seq percent confirming: | 34.4828 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCACAGAAGTCAGACGT |
| Suggested primer 2: | TAGGGCCTCCTACGAAAGCT |