Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.074335 |
Chromosome: | plastome |
Location: | 64441 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802291 | ChreCp027,psbZ,2716976 | photosystem II reaction center Z protein; (1 of 1) K02724 - photosystem II PsbZ protein (psbZ) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATCTAAACAGATTTAGAAAAACTTTTTTACTTTACTAGATAAGTCTAT |
Internal bar code: | AGTTCAACTATACGTTTACCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 98 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTAAGGGGAAAGGGACGTC |
Suggested primer 2: | ACGTTGCACCGTGTTTGTTC |