| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.074335 |
| Chromosome: | plastome |
| Location: | 64441 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802291 | ChreCp027,psbZ,2716976 | photosystem II reaction center Z protein; (1 of 1) K02724 - photosystem II PsbZ protein (psbZ) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATCTAAACAGATTTAGAAAAACTTTTTTACTTTACTAGATAAGTCTAT |
| Internal bar code: | AGTTCAACTATACGTTTACCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 98 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAAGGGGAAAGGGACGTC |
| Suggested primer 2: | ACGTTGCACCGTGTTTGTTC |