Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074355 |
Chromosome: | chromosome 12 |
Location: | 1481018 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g488050 | FFT5 | putative fructan fructosyltransferase; (1 of 1) 2.4.1.99//3.2.1.26 - Sucrose:sucrose fructosyltransferase / Sucrose:sucrose 1-fructosyltransferase // Beta-fructofuranosidase / Saccharase | 3'UTR |
Cre12.g488100 | UPF3 | (1 of 1) K14328 - regulator of nonsense transcripts 3 (UPF3, RENT3); UPF3 regulator of nonsense transcripts, NMD protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAGGCCTGGCAGCGCTTGCTGGGGGACTAGCGTGGTCCAACCGGGGA |
Internal bar code: | CGGGTGTTCGGGGTACATGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5286 |
LEAP-Seq percent confirming: | 65.9574 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGTTCGATGCTCTTCGCG |
Suggested primer 2: | GGGCCGGCTTTCAGATGTAT |