| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074902 |
| Chromosome: | chromosome 12 |
| Location: | 5082272 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525650 | SUFS,SUFS1,CSD4 | (1 of 1) K11717 - cysteine desulfurase / selenocysteine lyase (sufS); Group II cysteine desulfurase | 5'UTR |
| Cre12.g525700 | HCS1 | Cytochrome c heme lyase; (1 of 2) 4.4.1.17 - Holocytochrome-c synthase / Cytochrome c synthase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACAGCACACAGTTACTCGAGTAATCATGAGGTCACTAGCTCAAACGC |
| Internal bar code: | AAGTTAGGTTACGTTCGAATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 709 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAGGTAGACCAGGGGAT |
| Suggested primer 2: | CCAACGTCTACACCAGCCTT |