| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.074992 |
| Chromosome: | chromosome 16 |
| Location: | 1232405 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650900 | (1 of 1) IPR000104//IPR001965//IPR011011//IPR017956 - Antifreeze protein, type I // Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // AT hook, DNA-binding motif | 3'UTR | |
| Cre16.g650950 | (1 of 1) PF01931 - Protein of unknown function DUF84 (NTPase_I-T) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGTAGAACCCGTCGCCGAGATGTGCGTGTCCGCAGCGCCAAGAAGCG |
| Internal bar code: | GGCAACTCGGGCCACGCCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1736 |
| LEAP-Seq percent confirming: | 96.6667 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGACTCCGGCTACCTTG |
| Suggested primer 2: | TGGTGACGCACTAGAACCAC |