| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.074993 |
| Chromosome: | chromosome 12 |
| Location: | 8545676 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549100 | UAF3,SPL10 | splicing factor U2AF 65 kDa subunit; (1 of 2) PTHR23139//PTHR23139:SF58 - RNA-BINDING PROTEIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGAGGTGTTTGACTGATTTCTGACGAACGGTCGCTGGTTGACAGGGTC |
| Internal bar code: | GGTGAGATCCCGAAAACTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 221 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCGATCTCTCCATTCCA |
| Suggested primer 2: | TGACCCTTCTCGCTGTCAAC |