| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.076160 |
| Chromosome: | chromosome 3 |
| Location: | 4067143 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172050 | TFB4,TF2H3 | TFIIH 34kDa subunit; (1 of 1) K03143 - transcription initiation factor TFIIH subunit 3 (TFIIH3, GTF2H3, TFB4) | 5'UTR |
| Cre03.g172100 | PDF1A | Peptide deformylase; (1 of 1) PTHR10458//PTHR10458:SF11 - PEPTIDE DEFORMYLASE // PEPTIDE DEFORMYLASE, MITOCHONDRIAL | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTAATAAATCGGGAAGCAAGTCTATGAATGTGTCAATGAGCTGCACTGC |
| Internal bar code: | GTAGTGTTGGATTCCGGTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1346 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGAAGGGTATGGGCATG |
| Suggested primer 2: | TATTGCTCGCTCCTAGCTGC |