Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.076821 |
Chromosome: | chromosome 15 |
Location: | 2994107 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g643503 | HKR5,HKR6,HKR56,COP9,COP10 | (1 of 1) IPR000104//IPR001054//IPR001789//IPR003594//IPR003661//IPR004358//IPR005467//IPR011006//IPR029730//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Signal transduction response regulator, receiver domain // Histidine kinase-like ATPase, C-terminal domain // Signal transduction histidine kinase, dimerisation/phosphoacceptor domain // Signal transduction histidine kinase-related protein, C-terminal // Histidine kinase domain // CheY-like superfamily // Archaeal/bacterial/fungal rhodopsin-like // Nucleotide cyclase; Histidine kinase rhodopsin 5/6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGCTCACCTCTTCGCTCGCTTGCGTTGGGTTCGGTTTAGGTTTGGCTG |
Internal bar code: | CTCCTACGAAGAGTGGGCTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 134 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCTCGCTTGTTCGTGTTT |
Suggested primer 2: | TTGCGTGCATGTCAAACAGG |