| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.076887 |
| Chromosome: | chromosome 6 |
| Location: | 3806122 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278174 | (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | 3'UTR | |
| Cre06.g278175 | (1 of 1) K14793 - ribosomal RNA-processing protein 9 (RRP9) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAAAAACGCAACACGCACAAGCGAAGTGCATAGTGGCATAGGCATA |
| Internal bar code: | AGCAATGGCTGGTCGCAACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2329 |
| LEAP-Seq percent confirming: | 76.3889 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAGTATGGAGTGCTGGG |
| Suggested primer 2: | GGCACCAATAGCAAGCAACC |