Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.077438 |
Chromosome: | chromosome 16 |
Location: | 4189351 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g670250 | TOM6 | (1 of 1) K14964 - Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2); Translocase of mitochondrial outer membrane | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATTGCGCGCCCCTGCACAAGCATTAAAGCACTGGGATGTCACTGCTGG |
Internal bar code: | AGTGAACTTCTTCATGACGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3671 |
LEAP-Seq percent confirming: | 85.1562 |
LEAP-Seq n confirming: | 109 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 128 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCCACCTAATGACTGCTG |
Suggested primer 2: | CTTCAACGAGGGCACGTACT |