| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077685 |
| Chromosome: | chromosome 3 |
| Location: | 6751596 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196400 | EPC1 | (1 of 1) K11322 - enhancer of polycomb-like protein (EPC) | 5'UTR |
| Cre03.g196450 | (1 of 1) K15178 - RNA polymerase-associated protein RTF1 (RTF1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACACCTAGGACCCCTTGAAACCGCACTATACCTAGCGCTCTCTCATT |
| Internal bar code: | GTAAGTTATAGGGTAACTAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3914 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCCCGACGTGAAACCAAG |
| Suggested primer 2: | CGCTTCTAGGGCGCAAAATC |