Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.078755 |
Chromosome: | chromosome 3 |
Location: | 5334918 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g182950 | (1 of 1) K12820 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15/PRP43 (DHX15, PRP43) | 3'UTR | |
lncRNA_TCONS_00234526 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAGAGGGCCAGCGCTCAACACACCGCAGGCCTGAACAAAGGGCCTGAA |
Internal bar code: | GGGGTATACATTGTCGGCTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4981 |
LEAP-Seq percent confirming: | 77.5 |
LEAP-Seq n confirming: | 93 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 120 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCAATGCGCAGGTTATG |
Suggested primer 2: | GTGTGTGCTCAAGTGTGCAG |