| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.079033 |
| Chromosome: | plastome |
| Location: | 109621 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802311 | 2716998,ChreCp047,rpoC2 | RNA polymerase beta'' chain; (1 of 1) PTHR19376//PTHR19376:SF38 - DNA-DIRECTED RNA POLYMERASE // DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA'' | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTAATTTGGCAGTTTCCGAATAACTGTCGACTTCTCCGTTAAGTGCA |
| Internal bar code: | TATCAAGCGACTAGACACTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 306 |
| LEAP-Seq percent confirming: | 55.8824 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCTTTTGCGTCGAGTGGC |
| Suggested primer 2: | GCGCGCGTTAAAGAACTCAA |