Insertion junction: LMJ.RY0402.038407_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038407
Chromosome:chromosome_17
Location:3682106
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre17.g726850 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTTCGCAAGCGGATGCCTGGTCTGGCCTGG
Internal bar code:GGGAACGGCTCTCATCCCACTG

Confirmation - LEAP-Seq

LEAP-Seq distance:520
LEAP-Seq percent confirming:99.3204
LEAP-Seq n confirming:1023
LEAP-Seq n nonconfirming:7
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:GGGAGTGATTGGTACTGCGT
Suggested primer 2:GCTGATGTGCATGTCATTCC