Insertion junction: LMJ.RY0402.038424_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038424
Chromosome:chromosome_3
Location:7306113
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g206900 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACTGGGTAGAACAATACCGCACGGTGGACA
Internal bar code:CAACTGAATCGAACGGGGAAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:382
LEAP-Seq percent confirming:97.2561
LEAP-Seq n confirming:4785
LEAP-Seq n nonconfirming:135
LEAP-Seq n unique pos:31

Suggested primers for confirmation by PCR

Suggested primer 1:TCCATTGCAAGTTCAACCAA
Suggested primer 2:GCCACCCTACACACACACTG