Insertion junction: LMJ.RY0402.038424_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038424
Chromosome:chromosome_3
Location:7306168
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g206900 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCGTGCCTCACATCATCCCCTGGCCCGCCA
Internal bar code:TCTAGATCGCATTTCCTTGCGC

Confirmation - LEAP-Seq

LEAP-Seq distance:451
LEAP-Seq percent confirming:99.3056
LEAP-Seq n confirming:715
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TCCATTGCAAGTTCAACCAA
Suggested primer 2:GCCACCCTACACACACACTG