Insertion junction: LMJ.RY0402.038464_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038464
Chromosome:chromosome_3
Location:4558364
Confidence (%):58
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g176833 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GTGGCAGGGCGGCAGCGAGGGCGGTGGGGG
Internal bar code:TTTGGTCCAAGATGTCTGATTT

Confirmation - LEAP-Seq

LEAP-Seq distance:19
LEAP-Seq percent confirming:45.929
LEAP-Seq n confirming:220
LEAP-Seq n nonconfirming:259
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:TGAGCTTTGGACTACCCCAC
Suggested primer 2:GTTGAGAGGCTGCCGACTAC