Insertion junction: LMJ.RY0402.038466_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038466
Chromosome:chromosome_4
Location:2037015
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre04.g219000 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):AAGATGGTAAACAGCTCCTCATCGCTGTAG
Internal bar code:TAGTGTGGCCCCGTGCACTATC

Confirmation - LEAP-Seq

LEAP-Seq distance:324
LEAP-Seq percent confirming:99.4611
LEAP-Seq n confirming:12182
LEAP-Seq n nonconfirming:66
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:GGTTGAGCTTGACAAGGAGC
Suggested primer 2:TTGTGCGTTTGGCAATACAT