Insertion junction: LMJ.RY0402.038466_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038466
Chromosome:chromosome_10
Location:4111897
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g449750 PKS1 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGTGCTGTTGGGCCGCACCGGCAGGACGG
Internal bar code:ATTGGGTCCGAACGGAGCGGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:358
LEAP-Seq percent confirming:78.0899
LEAP-Seq n confirming:139
LEAP-Seq n nonconfirming:39
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:GAGAGTCTCTGCTGCTGCCT
Suggested primer 2:ATGTGTGAGAACAAGTGCGG