Insertion junction: LMJ.RY0402.038466_3

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038466
Chromosome:chromosome_10
Location:4111907
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g449750 PKS1 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ACCCGCCTCCGCCGCGAGCCACTTGGTCAC
Internal bar code:CCAGGACGTAAGTCCTCCAGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:378
LEAP-Seq percent confirming:90.4955
LEAP-Seq n confirming:895
LEAP-Seq n nonconfirming:94
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:GAGAGTCTCTGCTGCTGCCT
Suggested primer 2:ATGTGTGAGAACAAGTGCGG