Insertion junction: LMJ.RY0402.038472_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038472
Chromosome:chromosome_16
Location:2596108
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g661626 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCCGGCTAACATGCAAGAAGCCCTTTCCAA
Internal bar code:GCTTGGTTACCTTTATTGCAGC

Confirmation - LEAP-Seq

LEAP-Seq distance:849
LEAP-Seq percent confirming:99.4941
LEAP-Seq n confirming:10621
LEAP-Seq n nonconfirming:54
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:TGGGAATTTGTATTGGGCAT
Suggested primer 2:TGTTCTGCAACGCAGTAAGG