Insertion junction: LMJ.RY0402.038472_3

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038472
Chromosome:chromosome_16
Location:2596113
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g661626 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TGGGTTGCTCTCTGTTGTGCTGCTATGGCC
Internal bar code:TTAACTCATCCTCAACAGCGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:1052
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:72
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:TGTTCTGCAACGCAGTAAGG
Suggested primer 2:TGGGAATTTGTATTGGGCAT