Insertion junction: LMJ.RY0402.038476_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038476
Chromosome:chromosome_7
Location:4824427
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre07.g345900 DCL3 Dicer-like protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTCTAGTTATGCAAAACAACAACCATGGCC
Internal bar code:AGTATGTGGCTGATGGTCCGGC

Confirmation - LEAP-Seq

LEAP-Seq distance:404
LEAP-Seq percent confirming:98.8235
LEAP-Seq n confirming:336
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:20

Suggested primers for confirmation by PCR

Suggested primer 1:CACCGTCCTCATAAATGGCT
Suggested primer 2:GGCGTACAACCTGAGAGAGC