Insertion junction: LMJ.RY0402.038476_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038476
Chromosome:chromosome_7
Location:4824484
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre07.g345900 DCL3 Dicer-like protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCGAGCCCCGCACTTACGCAAAACTTATC
Internal bar code:GATGTGTGGTTGGTGAAGTCGT

Confirmation - LEAP-Seq

LEAP-Seq distance:3
LEAP-Seq percent confirming:11.68
LEAP-Seq n confirming:422
LEAP-Seq n nonconfirming:3191
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GGAAGACGCGGTAGCTGTAG
Suggested primer 2:GGCGTACAACCTGAGAGAGC