Insertion junction: LMJ.RY0402.038483_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038483
Chromosome:chromosome_16
Location:1282410
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g651400 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCGTATGCGATTCACATAGCCTCCCTCCC
Internal bar code:AGGAGCATGAAAAATTGGCGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:633
LEAP-Seq percent confirming:99.2537
LEAP-Seq n confirming:399
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGAGGTTGTCGTTGTTG
Suggested primer 2:CTTCACTACACTCCTCGCCC