Insertion junction: LMJ.RY0402.038483_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038483
Chromosome:chromosome_16
Location:1282417
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g651400 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGTATTGCCAGAGCTTTCCGTGCCAGGTGC
Internal bar code:CCGGTGCAATGAGTGTCGTTCC

Confirmation - LEAP-Seq

LEAP-Seq distance:386
LEAP-Seq percent confirming:98.5941
LEAP-Seq n confirming:6452
LEAP-Seq n nonconfirming:92
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGAGGTTGTCGTTGTTG
Suggested primer 2:CTTCACTACACTCCTCGCCC