| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.038699 |
| Chromosome: | chromosome 5 |
| Location: | 2057212 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234500 | (1 of 1) K11801 - WD repeat-containing protein 23 (WDR23) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTTGAACTGCGGCACGGACTGCCGACAT |
| Internal bar code: | ACATAGGCACTGGGTAGCGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 80.9296 |
| LEAP-Seq n confirming: | 692081 |
| LEAP-Seq n nonconfirming: | 163083 |
| LEAP-Seq n unique pos: | 136 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCAAAAAGCTCACGAGGC |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |