Insertion junction: LMJ.RY0402.038699_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038699
Chromosome:chromosome_5
Location:2057212
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre05.g234500 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGTTGAACTGCGGCACGGACTGCCGACAT
Internal bar code:ACATAGGCACTGGGTAGCGTGC

Confirmation - LEAP-Seq

LEAP-Seq distance:851
LEAP-Seq percent confirming:80.9296
LEAP-Seq n confirming:692081
LEAP-Seq n nonconfirming:163083
LEAP-Seq n unique pos:136

Suggested primers for confirmation by PCR

Suggested primer 1:GTTCAAAAAGCTCACGAGGC
Suggested primer 2:CCAGCCCAAACTAAACCAAA