| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039504 |
| Chromosome: | chromosome 16 |
| Location: | 3068884 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665250 | APE1,TEF6 | (1 of 1) PF11016 - Protein of unknown function (DUF2854) (DUF2854); Acclimation of photosynthesis to environment | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTATGATAAGCACCACCGCAAGTGCAA |
| Internal bar code: | ACGGCTCAAACCCAGAAAGCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 794 |
| LEAP-Seq percent confirming: | 98.8579 |
| LEAP-Seq n confirming: | 3722 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGAGAACTCCAGCACCAG |
| Suggested primer 2: | ATCTCTTTCGGGTCCATCCT |