| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.040385 |
| Chromosome: | chromosome 12 |
| Location: | 2022014 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510100 | ATG4,APG4 | Autophagy-related protein; (1 of 1) K08342 - cysteine protease ATG4 (ATG4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAGTAAAGCAGGCGGCGGTGCAATGGGA |
| Internal bar code: | AAGACACTGGGCGGCTATCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 98.8825 |
| LEAP-Seq n confirming: | 3451 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTAATGCGCCTCCTAAC |
| Suggested primer 2: | ACCGACCTAATGCACCACTC |