| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.040747 |
| Chromosome: | chromosome 1 |
| Location: | 7078585 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051174 | BLZ1 | (1 of 6) PF07716 - Basic region leucine zipper (bZIP_2); bZIP transcription factor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCTCGTTCCACGTTGCGAACCAAACA |
| Internal bar code: | AGGCATCACGCCTGCGCGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 817 |
| LEAP-Seq percent confirming: | 99.3958 |
| LEAP-Seq n confirming: | 4113 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCTGGGTCGTGCTGGTAT |
| Suggested primer 2: | CTTAGCAAAGAGGTGAGCCG |