Insertion junction: LMJ.RY0402.041083_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.041083
Chromosome:chromosome_1
Location:7071182
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g051050 FAP225 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCCTGCAAAAGCGGATGCCACATGGGCACA
Internal bar code:CCCCGACCACAATCTAGGTCGT

Confirmation - LEAP-Seq

LEAP-Seq distance:672
LEAP-Seq percent confirming:99.5355
LEAP-Seq n confirming:5357
LEAP-Seq n nonconfirming:25
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:CACAGATTCAGAGGCACGAA
Suggested primer 2:CACGCGACCCACATACATAG