Insertion junction: LMJ.RY0402.041731_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.041731
Chromosome:chromosome_3
Location:3049262
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CCGGCTGCGCCTCTGCCCCTGCCTCCGCCG
Internal bar code:CCTTCGTTTTGGGACGCGATTC

Confirmation - LEAP-Seq

LEAP-Seq distance:1215
LEAP-Seq percent confirming:99.6927
LEAP-Seq n confirming:11032
LEAP-Seq n nonconfirming:34
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:AGAAAATGGTGTACCGCGAC
Suggested primer 2:CATATGCTTGCGTGTGCTCT