| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042547 |
| Chromosome: | chromosome 8 |
| Location: | 2605994 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372800 | (1 of 1) K12830 - splicing factor 3B subunit 3 (SF3B3, SAP130, RSE1); Nuclear pre-mRNA splicing factor involved in polyadenylation, CPSF family | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCAACCACCACCGCCCAAACTTGCCCT |
| Internal bar code: | TCGCGCAAAGAGCCGAGGAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 813 |
| LEAP-Seq percent confirming: | 99.5476 |
| LEAP-Seq n confirming: | 6822 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTAGCAAGAAGGGACAAG |
| Suggested primer 2: | GTGCGGACAACAAATCCTTT |